A comparative guide to science denial
| Line 1: | Line 1: | ||
I guess I will use the statement "I've provided evidence, facts, definitions, and support" as an organizing structure here. | I guess I will use the statement "I've provided evidence, facts, definitions, and support" as an organizing structure here. | ||
| − | '''Definitions'''. It's a little hard to take seriously a statement that you've provided a definition after your last post. Your claim that we both just know what meaning is, that it doesn't require a definition. You say it's nothing to do with biological molecules but words, oh, yes, words, they have meaning. Your revert to analogies, again—one about SETI, not even "real words" this time, and claim that you've provided evidence outside of the analogies that "proves" that regular, biological processes cannot (or "virtually never) add new information. | + | '''Definitions'''. It's a little hard to take seriously a statement that you've provided a definition after your last post. Your claim that we both just know what meaning is, that it doesn't require a definition. You say it's nothing to do with biological molecules but words, oh, yes, words, they have meaning. Your revert to analogies, again—one about SETI, not even "real words" this time, and claim that you've provided evidence including some outside of the analogies I suppose that "proves" that regular, biological processes cannot (or "virtually never") add new meaningful information. |
You claim that it is self evident what meaning is, yet as pointed out on your beloved Conservapedia information page, German and English have different linguistic meanings for the same word "gift." I guess self evidence doesn't apply to Germans. | You claim that it is self evident what meaning is, yet as pointed out on your beloved Conservapedia information page, German and English have different linguistic meanings for the same word "gift." I guess self evidence doesn't apply to Germans. | ||
Revision as of 01:00, 15 May 2009
I guess I will use the statement "I've provided evidence, facts, definitions, and support" as an organizing structure here.
Definitions. It's a little hard to take seriously a statement that you've provided a definition after your last post. Your claim that we both just know what meaning is, that it doesn't require a definition. You say it's nothing to do with biological molecules but words, oh, yes, words, they have meaning. Your revert to analogies, again—one about SETI, not even "real words" this time, and claim that you've provided evidence including some outside of the analogies I suppose that "proves" that regular, biological processes cannot (or "virtually never") add new meaningful information.
You claim that it is self evident what meaning is, yet as pointed out on your beloved Conservapedia information page, German and English have different linguistic meanings for the same word "gift." I guess self evidence doesn't apply to Germans.
There is something about morphological structures associated with your non-definition of meaning, as you refer to them from time to time ("the instructions for hair, ears, butterfly wings"). Of course, this would make the case of teosinte "becoming" corn as we know it today, quite difficult to understand. How is that loss of meaning if there is new morphology? There is no objective way for two people to come to the same conclusion about biological meaning based on your non-definition.
Since you refuse (oh, yes, refuse) to define meaning, you again force me to be at a rhetorical disadvantage, as you an easily decide what you want meaning to be in your latest analogy. I know it can't be tautological, loss of meaning is not the same as mutation or loss of a genotype. If that were the case, then we've assumed an answer, a fallacy from the start.
Again, I can only come up with three possible definitions of "meaning":
- The linguistic association between an object, action or concept.
- The sequence of DNA bases (or their corresponding peptides and start and stop).
- Genes and their expression.
We can continue to explore the relationship to 1 and 2 & 3. We can talk about the lack of order of genes, Hox genes aside, and hence the lack of grammar. We can talk about the commonality of genes among different species, how Hamlet and Macbeth are essentially the same thing. We can talk about how viruses swap out part of their codes among each other, taking paragraphs from Hamlet and putting them into Macbeth. We can talk about how the codons are mostly nouns ("tyrosine" "alanine" etc.) along with stop and start, and how the genes are mostly verbs (express protein NOW for 1000 cycles). But again, I'm not sure why we would want to when we could look at a real biological description.
Perhaps you can enlighten us why antibiotic resistance, nylon-eating bacteria, and citrate eating bacteria all result from meaning loss. How do you know which amino acid sequences lead to poison in some animals and not in the host animal, and how that is related to meaning? Please tell us which has less meaning: "TCTTGCAAACGATGTCAGTATC" or "GTTCTCCTCAGGTTCCTTGGTT." Or out of "Ala-Met-Ile-Met-Thr-Pro" and "Ile-Val-Tyr-Asp-Asn-Val." What about "start at cycle 463-express 10,000 times-stop" or "start at cycle 143-express 1,000 times-stop"?
p
It starts to make me wonder if "I don't need to" really means "I can't."