User talk:Kingdamian1/Archive1

This is an archive page, last updated 10 September 2017. Please do not make edits to this page.

Archives for this talk page:

Section header added later so it would archive properly[edit]

Why'd you create both Essay:Specified Complexity and Debate:Specified complexity with almost identical content? I deleted the essay version. If it was in some important way different I can undelete it but they did appear to be identical. Christopher (talk) 16:39, 16 April 2017 (UTC)

Although debate pages don't have the word talk in them, they are talk pages.

On talk pages, please sign your comments using four tildes (~~~~) or by clicking on the sign button: on the toolbar above the edit panel. (You can indent successive talk page comments using one more colon (:) for each line.) Thank you. Christopher (talk) 16:44, 16 April 2017 (UTC)

Can you not[edit]

correct already correct capitalization and add random signatures everywhere? It leads to edit conflicts. Christopher (talk) 17:06, 16 April 2017 (UTC)

Seriously[edit]

Edit a debate once, then wait for a reply. Nobody cares whether you made a tyop. Christopher (talk) 17:31, 16 April 2017 (UTC)

Signing[edit]

You only need to sign at the bottom of your comment. Not the top. Christopher (talk) 17:57, 16 April 2017 (UTC)

Autopatrolled[edit]

You may have some odd opinions regarding evolution but you only edit the debate you made so I'm autopatroling you:

Because of your edits to and time on the wiki, Autopatrolled has been added to your user rights. This lets you bypass most of the abuse filters, bypass the CAPTCHA, and edit more frequently. If you have questions, ~~bleat~~ ask away.

We hope you enjoy your newfound POWER — and these external tools:

Google Scholar Button ^{(Chrome, Firefox)} searches your highlighted text in Google Scholar. Easily check academic citations!
web.archive.org and archive.today, among other tools, can save permanent copies of webpages. Never lose a crank website or racist Tweet ever again! Christopher (talk) 20:09, 16 April 2017 (UTC)

I'm getting really sick of this[edit]

Make one edit to a page then wait for a reply. Seriously. It leads to edit conflicts which are really annoying if they happen more than once. I'm starting to lose my patience. Christopher (talk) 20:22, 16 April 2017 (UTC)

It took 10 minutes for me to make that edit. It was 1 line. Seriously, one edit. Christopher (talk) 20:28, 16 April 2017 (UTC)

SorryKingdamian1 (talk) 04:58, 19 April 2017 (UTC)

It's fine, I was a bit too short tempered. Christopher (talk) 09:08, 19 April 2017 (UTC)

If I Were To Autopatrol You...[edit]

Would you make a pro-intelligent design/creationism article in mainspace, or would you mostly stick to the debate page? Also, like Christopher pointed out, would you hold up on editing typos to your text? We're not Grammar Nazis here. Well, usually not. RoninMacbeth (talk) 04:30, 19 April 2017 (UTC)

Why does it matter?^{— Unsigned, by: Kingdamian1 / talk / contribs}

It's a formality, if anything. RoninMacbeth (talk) 04:47, 19 April 2017 (UTC)

If you do want to stay and edit in mainspace, however, the autopatrolled gadgets will make it easier to do so. RoninMacbeth (talk) 04:55, 19 April 2017 (UTC)

Sssshhh! It's finally time for some...[edit]

Don't forget to get up and stretch your legs once in a while, old timer. For your health! Reverend Black Percy (talk) 22:33, 20 April 2017 (UTC)

I AM NOT OLD... There are lots of young people tired of IMMORALITY!--Kingdamian1 (talk) 23:38, 20 April 2017 (UTC)

I don't believe in speaking down to one's elders — as such, I'm sorry if I sounded flip. You've led a rich life old timer; I'll try to learn from you best I can. Reverend Black Percy (talk) 23:43, 20 April 2017 (UTC)

You are free to call me that... But I bet I am at least 10 years younger than you... Plus... I am not really offended...--Kingdamian1 (talk) 23:45, 20 April 2017 (UTC)

Mind doing me one last solid old timer? Could you please indent your posts properly using colons (:)? Much appreciated. Reverend Black Percy (talk) 23:51, 20 April 2017 (UTC)

Sure... Why not!--Kingdamian1 (talk) 23:54, 20 April 2017 (UTC)

Thanks! Just make sure they're the right amount too, and we're all set. Reverend Black Percy (talk) 00:00, 21 April 2017 (UTC)

Message to Kingdamian1[edit]

You have been banned for blanking, true.

But - swear words and calling other RW users (persons with certain mental disabilities) is disagreeable to all concerned, and makes people immediately disregard your arguments. Tying people into verbal knots (with or without humour) #works much better#.

Reiterating the same point on a fairly minor topic in many different ways does not convince people (who will think you have only one idea). Try and diversify.

What is the question to which blanking pages is the answer?

Have a nice day. 86.146.99.69 (talk) 10:26, 23 April 2017 (UTC)

I felt a little frustrated... Yes... I must apologize for that... I wont blank anymore!--Kingdamian1 (talk) 16:28, 26 April 2017 (UTC)

Can you...[edit]

Learn to use CORRECT punctuation AnD GRAMMAR, you recidivist ruffian. Christopher (talk) 20:40, 26 April 2017 (UTC)

I thought you weren't a grammar nazi.... --Kingdamian1 (talk) 21:50, 26 April 2017 (UTC)

Don't you mean pedant?

There is a correlation between 'use of good grammar (even if colloquial)' and 'thinking things through properly' - 'sloppy grammar and sloppy thought.' (Making allowances for usages in different varieties of English and those using a language other than their primary one.) 86.146.100.79 (talk) 21:58, 26 April 2017 (UTC)

I really hate to be that guy, but aequa relatio non habet rationem causandi #Can'tComeUpWith ACleverSignature 01:19, 27 April 2017 (UTC)

And does 'grammar nazi' come under 'the first derivative of Godwin's Law' - 'if you compare others present to Hitler, Stalin and related persons and concepts without justification you have automatically lost the argument'? 86.191.125.229 (talk) 09:48, 27 April 2017 (UTC)

if you get what I am saying... There is no need to correct me on a minor mistake!--Kingdamian1 (talk) 16:04, 27 April 2017 (UTC)

Whilst correcting someone for saying "effect" instead of "affect" is stupid, your weird capitalization gets irritating to the extent that it means people don't pay attention to what you is saying. Christopher (talk) 16:31, 27 April 2017 (UTC)

Just to remind you[edit]

Make sure you communicate with a user on their talk page like this (for example). Not on their user page. I'll give you the benefit of the doubt and assume that, as you're evidently new to wikis, you did it by mistake. Christopher (talk) 17:36, 27 April 2017 (UTC)

Not by mistake, really... I was frustrated... and had to take it out somewhere!...--Kingdamian1 (talk) 17:58, 27 April 2017 (UTC)

May I suggest not admitting that, as that's vandalism. Vandalism means you stay in the vandal bin. As for taking that frustration out, screaming in pillows, hitting a punching bag, CoD or Battlefield, or physical exercise are (purportedly, as I don't get frustrated all that often) good ways to take it out and get rid of it. Not vandalism. Cheers! #Can'tComeUpWith ACleverSignature 18:02, 27 April 2017 (UTC)

Suggestions[edit]

Put something on your User Page (preferably with the correct number of capitals and run through a grammar/spell check) before someone does it for you.
Argue 'the big things' in the case for intelligent design, not trivial little tweaks and adaptations which can be otherwise explained.
Enjoy yourself (by other means than blanking pages) 86.146.100.119 (talk) 10:13, 30 April 2017 (UTC)
The problem being there isn't a case for intelligent design, whenever someone mentions the specifics he says "I didn't want this to be a discussion about cyanide", whenever someone starts speaking more generally he says "whenever I try and talk specifically you make it about the bigger picture". Christopher (talk) 10:24, 30 April 2017 (UTC)

The problem with 'Intelligent Design': we are intelligent after a fashion, and we can design things - but if #we# were going to design the universe we would design it somewhat better and on a larger scale (and, possibly, leave a visible copyright mark/signature - or at least evidence of 'dealing with loose ends and unintended consequences).

The origins of the cyanide-protecting gene may well be the same as the lactose-tolerating one (a simplification) - and most of us most of the time only encounter limited amounts of cyanide. 86.146.100.119 (talk) 22:23, 30 April 2017 (UTC)

Cognitive dissonance at it's best... Keep telling that to yourself!--Kingdamian1 (talk) 16:39, 1 May 2017 (UTC)

You going to say anything useful or constructive or just throw around vague unsupported allegations? Christopher (talk) 16:42, 1 May 2017 (UTC)

This person is actually convincing him/herself that cyanide defense mechanism started out as a copying mistake... I can't argue against a mind that functions that way... ADDITIONALLY, I HAVE asked you to take me from the vandal bin... You have not done so, perhaps on purpose!--Kingdamian1 (talk) 19:56, 1 May 2017 (UTC)

Your rebuttal consisted of an ad hominem and nothing else. Yes, I haven't let you out of the vandal bin because you haven't shown that you'd benefit this site if I did. You shouldn't have wandalised pages if you wanted to stay out of the vandal bin. Christopher (talk) 19:58, 1 May 2017 (UTC)

I apologized... and pledged not to repeat vandalism... What else can I do? Can you, please, let me out!!!--Kingdamian1 (talk) 20:59, 1 May 2017 (UTC)

I did it, don't wandalize again. Christopher (talk) 21:08, 1 May 2017 (UTC)

Thanks--Kingdamian1 (talk) 21:31, 1 May 2017 (UTC)

Why are #you# accusing #me# of cognitive dissonance: you have yet to prove that the 'cyanide defence mechanism' proves Intelligent Design (rather than 'some ancient creatures had a marginally better survival rate with it and it has persisted - and likewise with a part of the human population and adult lactose tolerance).

You have a stuck needle on the cyanide defence mechanism.
You have a stuck needle on the cyanide defence mechanism.
You have a stuck needle on the cyanide defence mechanism.
You have a stuck needle on the cyanide defence mechanism.

(repeat ad nauseum)

And you can repeat your comment a thousand times and you will still not convince us (individually or collectively).

Try another topic. 86.191.125.180 (talk) 21:59, 1 May 2017 (UTC)

It has nothing to do with cyanide... I can try 100 topics if you want... OK... let's assume that rhodanese started out as a RANDOM copying mistake million years ago... What about the blood and brain barrier... the corneal reflex... the feeling of pain... the feeling of thirst... the sense of balance... the Hering–Breuer reflex... blood clotting... did these start out as random copying mistakes that later became advantageous?

SEE IT DOES NOT MATTER how many SPECIFIED and INTRICATE functions I show... YOU WILL ALWAYS continue to maintain that this can be explained by Random mutation and natural selection...--Kingdamian1 (talk) 22:38, 1 May 2017 (UTC)

DON'T use SO many CAPITALS - it MAKES you LOOK unprofessional.

If a 'random copying mistake' (or 'ordinary genetic variation') is effectively neutral it will persist; and if it provides a benefit, however marginal, and carriers have the opportunity to breed, then it will become a dominant.

Are you not convinced that the examples you provide do not convince the rest of us: and repetition, repetition, repetition tends to produce a negative response.

But - we are all very happy that something so trivial convinces you that Intelligent Design/God/etc exists (even if we individually and collectively wish for a more complex explanation to persuade us in turn). 31.51.113.95 (talk) 09:10, 2 May 2017 (UTC)

A very good point from the pleb - genetic variation, if neutral, remains in the generations. You're acting like it goes away after one and only the beneficial mutation remains. Let's take a look at 15 generations.

Gen. 1: AACTTCACGATCCACGGTCTACTCTGATCTACGCAGTCTACTCTAGTCACAATACTCGACTCGA
Gen. 2: AACTTCACGATCCACGGTCTACTCTGATCTACGCAGTCTACTCTAGTCACAATACTCGACTCGA
Gen. 3: AACTTCACGATCCACGGTCTACTCTGATCTACGCAGTCTACTCTAGTCACAATACTCGACTCGA
Gen. 4: AACTTCACGATCCACGGTCTACTCTGATCTACGCAGTCTACTCTAGTCACAATACTCGACTGGA
Gen. 5: AACTTCACGATCCACGGTCTACTCTGATCTACGCAGTCTACTCTAGTCACAATACTCGACTGGA
Gen. 6: AACTTCACGATCCACGGTCTACTCTGATCTACGCAGTCTACTCTAGTCACAATACTCGACTGGA
Gen. 7: AACTTCACGATCCACGGTCTACTCTGATCTACGCAGTCTACTCTAGTCACAATACTCGACTGGA
Gen. 8: AACTTCACGATCCACGGTCTACTCTGATCTACGCAGTCTACTCTAGTCACAATACTCGACTGGA
Gen. 9: AACTTCACGATCCACGGTCTACTCTGATCTACGCAGTCTACTCTAGACACAATACTCGACTGGA
Gen. 10: AACTTCACGATCCACGGTCTACTCTGATCTACGCAGTCTACTCTAGACACAATACTCGACTGGA
Gen. 11: ATGATCACGATCCACGGTCTACTCTGATCTACGCAGTCTACTCTAGACACAATACTCGACTGGA
Gen. 12: ATGATCACGATCCACGGTCTACTCTGATCTACGCAGTCTACTCTAGACACAATACTCGACTGGA
Gen. 13: ATGATCACGATCCACGGTCTACTCTGATCTACGCAGTCTACTCTAGACACAATACTCGACTGGA
Gen. 14: ATGATCACGATCCACGGTCTACTCTGATCTACGCAGTCTACTCTAGACACAATACTCGACTGGA
Gen. 15: ATGATCACGATCCACGGTCTACTCTGATCTACGCAGTCTACTCTAGACACAATACTCGACTGGA

I get that it might be a little bit of an elementary example, but if the mutations stay, that's evidence that they're neutral or beneficial. Now, I know that this was created by me. Therefore, it obviously isn't a perfect example, but we're trying here, OK? Also, a population wouldn't change three times in fifteen generations so give it, y'know, lots more time. Gangplank (talk) 10:29, 2 May 2017 (UTC)

Gangplank - who is 'you' in this case? Note I am distinguishing between 'the neutral and positive genes' and 'the carrier' (animal, vegetable, mushroom etc) for the purpose of the discussion/clarity. The impact of the genes can also vary according to context or change over time - and sometimes external factors can influence a particular species (for a non-human-influenced example the insect which surfaces every 17 years, and 'flowers and their pollinators.' 31.51.113.95 (talk) 11:59, 2 May 2017 (UTC)

'You' there is Damian. He's been around for a while on the Specified complexity page. And yes, I agree with all your points. Barrel! (Combo!) 12:53, 2 May 2017 (UTC)

I will again repeat that these functions are deeply specified and intricate... They are BEYOND a blind process... Take "blood and brain barrier for example...................The blood–brain barrier (BBB) is a highly selective semipermeable membrane barrier that separates the circulating blood from the brain extracellular fluid in the central nervous system (CNS). The blood–brain barrier is formed by brain endothelial cells, which are connected by tight junctions. The blood–brain barrier allows the passage of water, some gases, and lipid-soluble molecules by passive diffusion, as well as the selective transport of molecules such as glucose and amino acids that are crucial to neural function. Furthermore, it prevents the entry of lipophilic potential neurotoxins by way of an active transport mechanism mediated by P-glycoprotein. Astrocytes have been claimed to be necessary to create the blood–brain barrier................... How does this PARTICULARLY fit into a RANDOM copying mistake turning out to be advantageous over millions of years........ I am 100% certain that blind people like you WILL NOT be convinced... But I will repeat one more time.... The functions which I bring as examples are SPECIFIED... None of you ever goes out of their way to talk about this... As I repeated with various warning mechanisms (e.g corneal reflex, thirst, hunger, pain etc.) There is no evidence that these SPECIFIED functions can develop as a result of a blind process... Stop explaining to me how evolution is supposed to work... Eye color change, speciation, hair color change etc are all predictable and very much in accordance with what would be predicted from such a BLIND process..... But when we try to apply this same process to functions that would be required for microbe-man IT DOESNT WORK..... We would have to have had the evolution from asexual reproduction to sexual reproduction and all this from a BLIND PROCESS starting out as a RANDOM copying mistake.... Then of course the development of SPECIFIED functions.... It simple does not work......

Let's assume asexual-sexual was due to a copying mistake that became advantageous.... Now... The sexual arousal mechanism is NECESSARY (specified)... However a RANDOM MUTATION cannot know this, What are the chances of random copying mistake happening when it was supposed to (shortly after the evolution of sexual reproduction).... Without the sexual arousal mechanism reproduction would be limited....

Same thing with thirst... Thirst is ABSOLUTELY necessary with the presence of a the drinking ability.... But again a RANDOM copying mistake cannot know this... If this random copying mistake had not occurred.... Everyone who evolved the ability to drink would mostly die....

Same thing with the reflexes that control breathing.....

It simple does not/can not work... Random mutation + natural selection CANNOT explain the complexity we observe.... Simply because it STARTS OUT as RANDOM... and what we observe in life is SPECIFIED...--Kingdamian1 (talk) 15:58, 2 May 2017 (UTC)

Your logic is faulty, your imagination limited in the extreme, and your grammar and spelling are bad.

You have yet to prove anything is to do with the #Christian God# poking his fingers into life the universe rather than 'genes and their expression' having consequences.

It must be obvious to you by now that you are not going to persuade those members of RW who are still bothering to read your drivel to agree with you. 31.51.113.95 (talk) 22:02, 2 May 2017 (UTC)

Of course you are not going to offer up an evidence that my logic is flawed.... about the grammar... I used to edit everything here... but people told me that it was leading to an edit conflict.... and I should have just let it be.... Of course biased people, understandably have trouble processing this...--Kingdamian1 (talk) 22:15, 2 May 2017 (UTC)

'X proves that God exists because I say it cannot happen through "mistakes" (rather than random chance and only viable options survive)' #is# faulty logic (and the fact that nobody else has joined your side probably proves something) - and insulting those who disagree with you is "not biased"? There are obvious ways of avoiding edit conflict. 86.146.99.7 (talk) 09:39, 3 May 2017 (UTC)

Question[edit]

How does this discussion map onto the 'Atheistic Professor and the problem of evil' discussion? (The AP runs a book on when somebody will raise the question.) 31.51.113.95 (talk) 11:59, 2 May 2017 (UTC)

The problem of evil is a theological question... I would be glad to answer it... However most of you do not acknowledge that intelligence even exists... As an analogy... Would you try to explain why the earth is round to someone who does not believe the earth exists... I think not!--Kingdamian1 (talk) 16:01, 2 May 2017 (UTC)

You've used that analogy a lot, it's a false analogy. Your "Earth is round" analogy goes like this:

Person A doesn't believe in the Earth.
Before proving that the Earth is round you should prove it exists in the first place.

Your logic goes like this:

Person A doubts the existence of God and cites a specific reason
???
There's no point explaining why that specific reason is wrong

Totally different. Christopher (talk) 16:12, 2 May 2017 (UTC)

I did not mention a Christian God in this debate... I am rather talking about INTELLIGENCE... I am a Christian... and I would be happy to attempt to answer those questions... However they do not come from genuine curiosity but rather an arrogant belief that there is no possible answer to them!--Kingdamian1 (talk) 16:59, 2 May 2017 (UTC)

Ain't arrogant, there's been no answer (except atheism) for thousands of years. Arrogant would be thinking that you know more than all of those sohisticated theologians who didn't have the answer. Christopher (talk) 17:09, 2 May 2017 (UTC)

This is a theological question... I don't mind discussing it... But it is NOT asked from genuine curiosity... It is asked with belief that there cannot be any answer to this question... That being said... Unless you are 100% capable of understanding God's way (in which case he is not a God)... then you can not possible say that the existence of evil proves God does not exist... But again... there is no reason going to theology on here.... I am planning on opening a new debate page soon... called Secular Morality and you can join me there if you want!

But to repeat... Unless you can 100% prove that, for example, X suffering does not fit into God's plan... THEN YOU CANNOT say that the problem of evil proves atheism--Kingdamian1 (talk) 17:16, 2 May 2017 (UTC)

So your basic argument is we cannot define/understand God? I have a response to that argument but I want to check I'm not straw manning your position before I answer you. Christopher (talk) 17:18, 2 May 2017 (UTC)

Not really... What I am saying is... Unless someone who claims that the existence of suffering proves atheism true... Then that someone should 100% be understanding God's plan... Since that is not possible, by the very definition of Him being God... Then you CANNOT prove that the existence of evil proves atheism true!--Kingdamian1 (talk) 17:22, 2 May 2017 (UTC)

Kingdamian1 - we here accept you have convinced yourself of the validity of your arguments: just accept that we are not so convinced, and have different reasons to believe in 'deity/ies' of our choice (or none). By blanking pages and attacking people's intelligence individually and collectively you are convincing us to investigate your arguments even less.

Soon you will be talking to the proverbial empty room (and the truth will be elsewhere).

Now go and look at [1] and similar. 82.44.143.26 (talk) 17:30, 2 May 2017 (UTC)

Is God willing to prevent evil, but not able? Then he is not omnipotent.

Is he able, but not willing? Then he is malevolent.

Is he both able and willing? Then whence cometh evil?

Is he neither able nor willing? Then why call him God?

- Epicurus

[God's] power we allow [is] infinite: Whatever he wills is executed: But neither man nor any other animal are happy: Therefore he does not will their happiness. His wisdom is infinite: He is never mistaken in choosing the means to any end: But the course of nature tends not to human or animal felicity: Therefore it is not established for that purpose. Through the whole compass of human knowledge, there are no inferences more certain and infallible than these. In what respect, then, do his benevolence and mercy resemble the benevolence and mercy of men?

- David Hume

Parrrley 17:47, 2 May 2017 (UTC)

So your argument is that the holocaust and insects whose whole life cycle consists of burrowing into the eyes of children and turning them blind (to name a few examples) were good for the world? Christopher (talk) 17:51, 2 May 2017 (UTC)

NO I DO NOT!!! Holocaust is the product of man's sinful nature... And detachment from God... Since there is no absolute good (God)... morality is whatever the majority decides... Holocaust is a Good example of why we need God... I am not saying other of your examples are goof per se... What I am saying is, BY DEFINITION THEY CANNOT by themselves diprove the existence of God!--Kingdamian1 (talk) 18:03, 2 May 2017 (UTC)

I think he's using the Creation-Order theodicy? Damian, you still haven't touched the logical problem of evil. Well, if I'm steelmanning your comment there, it uh looks like you're kinda sorta referring to Plantinga's Free Will Defence? Yeah I think you're using the FWD. The C-O theodicy and the FWD still don't answer why evil exists apart from humanity, like natural disasters, though. Parrrley 18:08, 2 May 2017 (UTC)

God created humanity in (deity pronoun)'s image.

Humanity is (#KD1# says) sinful.

Therefore what can we deduce about God?

There is no direct proof that God/Chtulhu/the FSM/Invisible Pink Unicorn/Thoth and Thor/any other deity of choice exist - and no direct proof that such entities do not exist.

Anyone - where does the quote which roughly goes 'People are free to choose - but they have to choose to do rightly' come from?

Any suggestions as to where in 'the tubes' this discussion should be continued? 82.44.143.26 (talk) 18:20, 2 May 2017 (UTC)

(Edit conflict)

God didn't stop the Holocaust
God could've stopped the Holocaust (or he wouldn't be omnipotent)
God deliberately allowed millions of innocent people to be murdered

Conclusion: God's a dick

Christopher (talk) 18:22, 2 May 2017 (UTC)

What you are saying about there being many gods and therefore atheism being true is equivalent to saying that since different students got different answers there must be no answer to the equation... Let me help you with some of the gods you have named.... FSM is a parody of religion... so obviously not a God.... Thor is a man who gets married and has children (same goes for Zeus and most of pagan gods)... that would mean he is subject to natural laws... therefore he could not have created them... Chtulhu is admited to be fictional... Pink unicorn can by no means be defined as the law giver and the creator... So using this way we can empty this stupid idea that since societies have had many gods nothing can possibly exist... We are left with 2 choices (not 2400... not 1000 BUT 2)... Intelligent creator vs Humanist interpretation! As for there being no evidence for an INTELLIGENT creator... You could not have been further from the truth... take up the argument from the 1st cause... teleological argument... and the argument from degrees to name a few! Please, stop using Richard Dawkins'm ridiculous arguments... At least he is smart enough to choose who he debates, and not get his crap exposed!--Kingdamian1 (talk) 18:30, 2 M:ay 2017 (UTC)

Many people do sincerely believe in Gods other than the one you espouse, and behave in totally honourable ways etc.

There are more positions than the two you suggest - and #nothing you have said proves your case#, and you have not proved the case for an intelligent creator (or, indeed, that #you# are intelligent).

Please stop insulting people as it makes you look silly (to say the least).

(Another person leaving the room - and the Captcha question is 'lucky you'). 82.44.143.26 (talk) 18:42, 2 May 2017 (UTC)

I understand you may not have seen it but I made a comment you haven't answered yet (above the one about Thor).
The FSM doesn't care whether you believe in Him or not, therefore the fact that no one seriously believes in Him isn't evidence against his existence. Same with the IPU (PBUH, MHHHNBS).
What about Allah? Yahweh? Brahmah? Whatever the Sikh God is called? (I can't remember of the top of my head and Wikipedia doesn't have the answers). The thousands of other creator gods that have existed throughout history? Christopher (talk) 18:45, 2 May 2017 (UTC)

Um... Christopher... What I attempt to do is show you that the problem of evil is NOT a good argument for atheism... If however you are not asking it in an arrogant belief that there is no possible answer.. but are genuinely interested... I would like to tell you that I too at some point have had the same questions, more specifically about my life... This in no way is a reason for atheism... If you have questions such as this... it is just an indicator that your mind is working!

Another point you bring is societies worshiping multiple deities... And this is no argument for atheism... I will bring the example again... If students got different answers on the same test... would this prove there is no answer to the equation? Of course not!--Kingdamian1 (talk) 19:58, 2 May 2017 (UTC)

It wouldn't, what I'm trying to say is "what makes your answer the correct one?" I don't think there's anything special about Christianity that means it's way more likely to be correct but I'm happy to be proven wrong. Christopher (talk) 20:41, 2 May 2017 (UTC)

I see this a lot... NO... IT IS NOT my answer... There is multiple reasons why I am a Christian... But this brings us to the same analogy... The earth is round is a CORRECT answer.... The earth is flat is the WRONG answer... Now there is a third person who says he does not see the evidence of earth's existence and does not believe the earth exists, and one of the reasons he does not believe is because some people claim the earth is flat... others claim earth is round... some have claimed in ancient India... that the earth was resting on elephant shoulders etc... See how ABSURD it is... People have had different views on JUST ABOUT ANYTHING... For me to explain why Christianity is the most reasonable explanation... you must be at least accepting that the INTELLIGENCE exists... since you do not accept this... there is NO POINT IN talking about the specific intelligence... If you dont own a dog... I wont be asking what BREED......... If you dont accept the earth exists... there is no point in answering what shape it is.....

These questions ONLY become relevant once you accept Intelligence... Richard Dawkins throws around these claims (Most of us are atheistic about many god's and some of us go one god further)... And honest people like you take up this claim thinking it makes sense... But notice how he refuses to debate William Lane Craig for example... He would expose this flaw and then he would have to stop using it! Therefore he makes up some claims and mostly cherry picks who he debates! I hope you will see this pattern!--Kingdamian1 (talk) 21:02, 2 May 2017 (UTC)

Are you still going on about this? Just let it die man. 2d4chanfag (talk) 02:52, 3 May 2017 (UTC)

Who is this 'third person' who does not believe in the Earth's existence (and is not undergoing psychiatric treatment as an in patient)?

We all have our pet beliefs - which will elicit a range of responses from 'I agree' to 'We are both partly in the right/let us agree to differ' to 'I couldn't agree less.' Unfortunately for you most Rationalwikians fall into the last category. KD1 - just accept that you will never convert us benighted natives of Rationalwiki (or at least not without a lot more facts and fewer statements). 86.146.99.7 (talk) 12:54, 3 May 2017 (UTC)

Hey there Champ[edit]

I'd really like it if you answered my question on the If I CALL my OPPONENTS smug I'm automatically RIGHT!!!!!!!!!!!‎ page. Also, consider the fact that while you call me stupid, I'm the one who's spelling things right, using correct grammar, and not having an aneurysm while typing. Vive Liberté! 16:35, 10 May 2017 (UTC)

Your explanation of what you base your "morals" (yes in parenthesis) on was stupid AT BEST!!--Kingdamian1 (talk) 20:54, 10 May 2017 (UTC)

What? I don't recall Koi ever mentioning morality, also I presume you mean quotation marks not parenthesis. Christopher (talk) 21:01, 10 May 2017 (UTC)

So Kantianism is stupid at best? Huh. <sarcasm>TIL...<./sarcasm> Vive Liberté! 01:59, 12 May 2017 (UTC)

Indent your talk page comments[edit]

Indent your comments with a colon (:) like this:

Donald Trump is the antichrist.

:No he isn't, he's Satan!

::Hey! Satan's a nice guy, don't go comparing him to Donald Trump.

:::Blasphemy! Satan is pure evil!

::::Oh really? At least he isn't a mass murderer, unlike some people.

:::::Good point, praise Satan!

::::::You realise Satan isn't real?

:::::::You can't prove he isn't real

::::::::You can't prove he is real.

:::::::::You just gotta have faith

::::::::::Why should I have faith in your God and not the flying spaghetti monster, the invisible pink unicorn or Thor?

:::::::::::Because you must have faith in Satan! Praise Satan!

Which produces this:

Donald Trump is the antichrist.

No he isn't, he's Satan

Hey! Satan's a nice guy, don't go comparing him to Donald Trump.

Blasphemy! Satan is pure evil!

Oh really? At least he isn't a mass murderer, unlike some people.

Good point, praise Satan!

You realise Satan isn't real?

You can't prove he isn't real

You can't prove he is real.

You just gotta have faith

Why should I have faith in your God and not the flying spaghetti monster, the invisible pink unicorn or Thor?

Because you must have faith in Satan! Praise Satan!

Christopher (talk) 17:44, 11 May 2017 (UTC)

Donald Trump is evidence that there are descent people still living, who reject liberal dogma!!!!!!!!!!!!!!!!!!Kingdamian1 (talk) 17:48, 11 May 2017 (UTC)

You only need to use one more colon than the previous comment.

I wasn't seriously suggesting that Donald Trump was the anti christ. Christopher (talk) 17:57, 11 May 2017 (UTC)

Let me ask you a q... How do you read someone's writing so fast... If i were to blank a page... or vandalise it... How would u find it so quickly???--Kingdamian1 (talk) 18:12, 11 May 2017 (UTC)

I can see if anyone has recently edited a page using this, is that what you meant? Christopher (talk) 19:08, 11 May 2017 (UTC)

... why is he asking how quickly we could find out if he vandalised something? We can also use this to check your edits in particular. Vive Liberté! 03:05, 12 May 2017 (UTC)

We are always watching, KD. Allllways. And you don't even know some of us are here. --Maxus (talk) 03:10, 12 May 2017 (UTC)

I don't mind you watching... I don't vandalise anymore... But if I make good contributions... does that count... ?--Kingdamian1 (talk) 03:34, 12 May 2017 (UTC)

Now, that's a BIG "if". Either way, start by indenting your posts properly. Thanks. Reverend Black Percy (talk) 10:58, 12 May 2017 (UTC)

(doing a colon-otomy) Does 'descent people' mean that Kingdamien1's subconscious believes in humans having evolved? (creatively misconstruing 'Freudian slip') 82.44.143.26 (talk) 14:58, 12 May 2017 (UTC)

What a wonderful example of ~~cherry picking~~ a Freudian slip haha. Your comment made me laugh, BoN. :) Vive Liberté! 15:08, 12 May 2017 (UTC)

Glad you liked it.

Should we wait until KD1 is unbanned before making comments on his misspellings etc? 82.44.143.26 (talk) 15:24, 12 May 2017 (UTC)

He's not currently blocked, here's a list of his blocks. As of 15:38, 12 May 2017 (UTC) the last block is a one second one by me (for "being a creationist"). Christopher (talk) 15:38, 12 May 2017 (UTC)

His misspellings and odd-at-best use of caps is nothing new. We're kinda concerned for his health, though. Vive Liberté! 15:51, 12 May 2017 (UTC)

I wouldn't "diagnose" people over the internet, even jokingly. Christopher (talk) 16:17, 12 May 2017 (UTC)

Are you diagnosing the act of diagnosing others over the internet over the internet? Reverend Black Percy (talk) 16:26, 12 May 2017 (UTC)

By their deeds shall you know them - and Kingdamian1 #does# have a certain consistency. 31.51.114.83 (talk) 22:17, 12 May 2017 (UTC)

Could you stop...[edit]

Making random "essays" which are just links to your YouTube channel? You can link to it as much as you like on your userpage. Christopher (talk) 09:12, 20 May 2017 (UTC)

Even better: find a wikifarm and create your own wiki - you can then post your essays and exert full editorial control without inviting RW snark. 31.49.137.244 (talk) 10:10, 20 May 2017 (UTC)

Blanked page[edit]

I see that you blanked the page [[Fun:Science Hierarchy‎]] shortly after you created it. Do you want the page deleted or are you going to continue working on it? Bongolian (talk) 02:48, 22 May 2017 (UTC)

I prefer it deleted for now... Thanks --Kingdamian1 (talk) 03:46, 22 May 2017 (UTC)

My question[edit]

You refuse to answer me because 'my moral system is stupid at best', which has nothing to do with the relavence of the question. Please answer this comment.

“”Ohhhhh I get it. We're saving them! How could I have been so blind?! Well.. um.. well I probably shouldn't mention this but.. No, I'm not going to. I really won't. I promise. Have another quote:

"If you buy a Hebrew slave, he is to serve for only six years. Set him free in the seventh year, and he will owe you nothing for his freedom. If he was single when he became your slave and then married afterward, only he will go free in the seventh year. But if he was married before he became a slave, then his wife will be freed with him. If his master gave him a wife while he was a slave, and they had sons or daughters, then the man will be free in the seventh year, but his wife and children will still belong to his master. But the slave may plainly declare, ‘I love my master, my wife, and my children. I would rather not go free.’ If he does this, his master must present him before God. Then his master must take him to the door and publicly pierce his ear with an awl. After that, the slave will belong to his master forever. (Exodus 21:2-6 NLT)"

I guess this means that if we take the family hostage we can force him into become a slave for life? Good rule to have on hand. It ensures endless free labour too. Ok I broke. I'm gonna do it. I'm gonna mention it. Exodus 21:7.

"When a man sells his daughter as a slave, she will not be freed at the end of six years as the men are. If she does not please the man who bought her, he may allow her to be bought back again."

You see why I have problems with the Bible? Let me paraphrase that for you. "When a man sells his daughter as a sex slave, she will not be freed at the end of six years as men are because she's a woman and women are second class citizens and have no rights. If she doesn't please the man who bought her, her dad can buy her back, but no matter what you do you can't buy back her innocence because hey, you sold her as a sex slave. Sound like something that should be in the Bible? Sound like something a perfectly just and moral God would say? Nah, I don't think so either. Vive Liberté! 12:53, 11 May 2017 (UTC)

Thanks. Vive Liberté! 10:54, 12 May 2017 (UTC)

1 at a time pls... Slavery back then wasn't the same way you imagine it... Back then... those "brothers" became slaves because of bankruptcy... In other words... they couldn't pay anymore... So they had to serve them 7 years to repay the debt... If the chose to stay with their master... they were granted their wish... NO! WE ARE NO LONGER IN A DESERT... so these rules DO NOT APPLY NOW!--Kingdamian1 (talk) 15:50, 12 May 2017 (UTC)

A nonsense answer. You don't address the fact that we could take the family hostage to force him into slavery permanently. You don't address the fact that God allows men to sell their daughters as sex slaves. You don't address the fact that God condoned this previously, and instead handwave over it with a 'WE ARE NO LONGER IN A DESERT... so these rules DO NOT APPLY NOW!'. The very fact that God previously condoned this is a red flag for his perfect morality. Vive Liberté! 15:53, 12 May 2017 (UTC)

Also, I assume that morality (which, let's say for the sake of argument, is derived from God) is absolute and unchanging. Right? RoninMacbeth (talk) 16:29, 12 May 2017 (UTC)

What does that have to do with different legal systems... ?--Kingdamian1 (talk) 18:08, 12 May 2017 (UTC)

Why, it has everything to do with it. God is perfect, no? And is the Israeilite law not laid out by God himself? Ergo, if God is perfect, then the laws stemming from God are, logically, perfect as well. Which means that any approval of slavery, implicit or otherwise, must be part of a perfect legal system. RoninMacbeth (talk) 00:02, 13 May 2017 (UTC)

Do you eat 'pig meat', shellfish or other forbidden foods?

The Bible allows slavery and other things now considered 'unsuitable, inappropriate or abhorrent' (and is slightly inconsistent in parts as well). How does that square with your philosophy? 31.51.114.83 (talk) 22:23, 12 May 2017 (UTC)

Why no response? 86.191.125.216 (talk) 21:26, 13 May 2017 (UTC)

@Kingdamian A coherent defense of Slavery in the Bible would be interesting. Perhaps you could read the article before commenting as many verses are mentioned.--Bob ^{"Life is short and (insert adjective)"} 10:42, 26 May 2017 (UTC)

Could you please stop[edit]

Spamming the wiki with links to your YouTube videos? Christopher (talk) 20:51, 22 May 2017 (UTC)

IS that against the rules?--Kingdamian1 (talk) 21:44, 22 May 2017 (UTC)

'For you we will make an exception' 86.146.100.119 (talk) 21:51, 22 May 2017 (UTC)

Huh?--Kingdamian1 (talk) 22:30, 22 May 2017 (UTC)

I don't think it's explicitly against the rules, it's just a bit annoying. Christopher (talk) 15:56, 25 May 2017 (UTC)

Point taken--Kingdamian1 (talk) 16:02, 25 May 2017 (UTC)

Indenting properly[edit]

Hi! Just a quick heads up.

Observe the difference here, please. This is how to indent properly. Make sure you do as well!

As such, for example — when replying to this post (assuming you are the first to do so), one (1) colon is warranted. Thanks in advance. Reverend Black Percy (talk) 10:50, 26 May 2017 (UTC)

How many colons in a row is 'too many'? 86.191.125.198 (talk) 12:32, 26 May 2017 (UTC)

More than N colons + 1. For instance:

this isn't too many colons

this is too many colons

See how this works? Vive Liberté! 12:36, 26 May 2017 (UTC)

Referring to the 'adding one colon for each comment' - how close to the centipede-colon before the next commentator #should# reset? 86.191.125.198 (talk) 12:44, 26 May 2017 (UTC)

What's a centipede-colon? Christopher (talk) 13:44, 26 May 2017 (UTC)

Think of the colons as pairs of centipede's footprints :)

How many colon-indents before the text gets squashed to single-letter-vertical layout on the right hand side? 86.191.125.198 (talk) 21:36, 26 May 2017 (UTC)

This is probably too many colons. Christopher (talk) 08:36, 27 May 2017 (UTC)

Atheism is a Disease[edit]

Donate money to find the cure! Together we can beat this sickness--Kingdamian1 (talk) 07:48, 27 May 2017 (UTC)

Not being a Shia Muslim is a disease, together we can find the cure. Not being a Sunni Muslim is a disease, together we can find the cure. Not being a Sikh is a disease, together we can find the cure. Not being a Buddhist is a disease, together we can find the cure. Not being a Jain is a disease, together we can find the cure. My being a Jew is a disease, together we can find the cure. Not being a Catholic is a disease, together we can find the cure. Not being a Protestant is a disease, together we can find the cure. Christopher (talk) 08:23, 27 May 2017 (UTC)

Kingdamian - Richard Dawkins would call religion a disease.

Just accept different people have their own 'ways of viewing the world and ethical systems' and at least some of them will have a good afterlife. 86.146.99.29 (talk) 10:09, 27 May 2017 (UTC)

Dawkins calls religion a disease because he's a dick, don't stoop to Damian's levels. Christopher (talk) 10:58, 27 May 2017 (UTC)

Christopher, believing that there is no intelligence or purpose behind this life is a disease. Not believing in a SPECIFIC denomination is something different. Dawkins is NOT a dick. He is a man who was abused as a child in a boarding school (strict one I imagine), and is trying to take out his anger on what he perceives as an authoritarian figure.--Kingdamian1 (talk) 15:09, 27 May 2017 (UTC)

Why is it a disease? Christopher (talk) 15:10, 27 May 2017 (UTC)

Because it spreads quickly under the delusion of "knowledge" (is contagious). Those who have it, don't realize they do until it is too late. And it is a depressing worldview that "okay-s" abortion (murder), euthanasia. NOT TO MENTION... disrespect towards elders, arrogance. And might lead to suicide! This neurological disorder should be eradicated. I presume you yourself were contaminated from your parents? It's ok. Don't lose hope. We will develop the cure in your lifetime!--Kingdamian1 (talk) 15:14, 27 May 2017 (UTC)

There are many pro life atheists (and abortion isn't murder), how does it lead to arrogance and disrespect towards elders? My mother is a Christian and I didn't find out my father was an atheist until after I "converted", religion really isn't an issue in the UK. Christopher (talk) 15:38, 27 May 2017 (UTC)

All atheists not suffering from clinical depression aren't really atheists? Christopher (talk) 15:40, 27 May 2017 (UTC)

They may very well be pro-life... But if NOTHING MATTERS, and we make up morals using consciousness that DOES NOT EXIST to begin with... there is no reason to be pro-life or pro-choice because, well, haha, NOTHING matters!!!! Yes... Any atheist, who does not suffer from severe uni polar (clinical) depression is an atheist by name only... Much like you... You live, at least try to... with a purpose, decently and try to respect others... THIS IS IN SHARP contrast to what your philosophy teaches... that NOTHING MATTERS! (your own words... "Nothing matters, including this")--Kingdamian1 (talk) 15:44, 27 May 2017 (UTC)

The fact that nothing matters doesn't matter though. Christopher (talk) 15:45, 27 May 2017 (UTC)

EXACTLY! and you forgot to mention... that decision is reached by consciousness that DOES NOT EXIST!Kingdamian1 (talk) 15:47, 27 May 2017 (UTC)

How is that "EXACTLY"? Do you actually read what other people post? Christopher (talk) 15:51, 27 May 2017 (UTC)

You did confirm that nothing matters... And you do not deny that this decision is reached by consciousness that does not exist!--Kingdamian1 (talk) 15:53, 27 May 2017 (UTC)

┌────────────────────────────────────────────────────────────────────────────────────────────────────┘I don't think you quite realise how little I care that nothing matters, I've never suggested consciousness wasn't a useful concept. Christopher (talk) 15:57, 27 May 2017 (UTC)

But it DOES NOT exist... You are not aware that you are aware... It is a lot of atoms interacting in a specific manner, which came about by abiogenesis... Again caring is done consciously... AND CONSCIOUSNESS does not exist...--Kingdamian1 (talk) 15:59, 27 May 2017 (UTC)

Of course consciousness exists, when you're alive and awake you're conscious an when you're dead you're not. Christopher (talk) 16:03, 27 May 2017 (UTC)

What is life and death... The only difference is the way atoms behave... You thinking and talking is not very much different from ocean waves crashing, mars orbiting the sun... In fact there is not much difference between non-living and living... You die means your atoms can no longer behave in a way to cause your neurons to interact and result in you speaking... It is a depressing, sad view...--Kingdamian1 (talk) 16:06, 27 May 2017 (UTC)

Kingdamian1, are you seriously trying to claim that you are not a conscious being? Daev (talk) 16:08, 27 May 2017 (UTC)

He's claiming that this is what atheists REALLY BELIEVE, not that he believes it. Christopher (talk) 16:09, 27 May 2017 (UTC)

In an atheistic view... Neither of us are... Because the concept of consciousness does not exist... You can check Daniel Dennett's view of consciousness if you do not trust me... Again... If consciousness is simply atomic behaviour on an expanding universe that started from nothing... Then it does not exist... In other words... you are not aware that you are aware!Kingdamian1 (talk) 16:11, 27 May 2017 (UTC)

Rocks are just collections of atoms and they exist, why's consciousness any different? Christopher (talk) 16:14, 27 May 2017 (UTC)

Consciousness exists in a clinical sense... Let me explain oceans crash because the moon causes a tidal bulge... You are speaking because your atoms interact that way... and this began by chemicals forming the first DNA 3.7 billion years ago... on a giant rock that formed 4.54 billion years ago from an expansion of NOTHING 13.8 billion years ago!Kingdamian1 (talk) 16:17, 27 May 2017 (UTC)

Why is it a given that I adhere to Mr Dennett's philosophies? In the rest of the post in which you mention him, the statement that '(consciousness) does not exist' does not logically follow from the reference to atomic behaviour. lso the assertion that I am not aware of being aware can be rebutted simply. "Yes. I am."Daev (talk) 16:29, 27 May 2017 (UTC)

You can keep saying that... but your view says (given you are an atheist) you're not! Consciousness is a genetic copying error! Kingdamian1 (talk) 16:32, 27 May 2017 (UTC)

I'll state this again. You do not know what my religious beliefs are. Don't assume.

How does the origin of consciousness as genetic copying error (which is not a statement I would put my own name to) preclude the actuality of said consciousness? Daev (talk) 16:56, 27 May 2017 (UTC)

I am not talking about you specifically. If consciousness is something automatic and arises materially... then it would only be considered a well developed instinctKingdamian1 (talk) 20:49, 27 May 2017 (UTC)

(reset) Children who have not been brought up in a faith know they exist.

Quite a few animals appear to know that they exist (they have a sense of humour).

There is no direct connection between 'being conscious' and 'having a faith.'

Are you, Kingdamian1 arguing that anyone who does not believe in your particular faith does not have consciousness. Where do eg truly believing Communists (of whatever persuasion - 3rd, 3 1/2, 4th, 5th International, other) fit into your system? Or the concepts of beauty and humour?

Where did I pick up the concept to the effect that the behaviour of 'things operating at one level' does not necessarily predict what will happen at a more complex level? 86.146.99.29 (talk) 21:06, 27 May 2017 (UTC)

NO! Consciousness DOES EXIST... In an atheistic view (not mine)... you are ONLY clinically conscious! You are NOT aware that you are aware!Kingdamian1 (talk) 21:09, 27 May 2017 (UTC)

Who is proponent of this theoretical atheist viewpoint?

Cogito ergo sum.

I know I exist, I have conscious and conscience.

The more you, KD1, use verbals against anyone who does not automatically support your viewpoint, the less convincing you become, and the more it appears you have problems with your worldview (whether separate from, or because of your interactions with, Rationalwiki). 86.146.99.29 (talk) 21:21, 27 May 2017 (UTC)

As an atheist, I know my arse doesn't exist - it's just atoms. KingDamian, in his theistic foolishness, believes that his rear atoms are infused with bum-spirit - a sort of "arse-soul" - that makes his butt really exist. If he can prove his arse-soul exists by talking out of it, he will convert all the heathens. 90.214.247.107 (talk) 18:33, 30 May 2017 (UTC)

That genuinely made me laugh. Christopher (talk) 18:39, 30 May 2017 (UTC)

Don't start page blanking again[edit]

Because of your edits to and time on the wiki, Autopatrolled has been added to your user rights. This lets you bypass most of the abuse filters, bypass the CAPTCHA, and edit more frequently. If you have questions, ~~bleat~~ ask away.

We hope you enjoy your newfound POWER — and these external tools:

Google Scholar Button ^{(Chrome, Firefox)} searches your highlighted text in Google Scholar. Easily check academic citations!
web.archive.org and archive.today, among other tools, can save permanent copies of webpages. Never lose a crank website or racist Tweet ever again! Christopher (talk) 16:06, 27 May 2017 (UTC)

You're really not earning yourself any friends[edit]

By claiming a large percentage of the users of this site are mentally ill, it shouldn't be used as an insult for a start. Christopher (talk) 16:52, 27 May 2017 (UTC)

I don't mind rational wiki... Aren't you my friend?--Kingdamian1 (talk) 20:47, 27 May 2017 (UTC)

Why are you here Kingdamian1?

(RW or on Earth - take your pick.)

There is far more to heaven and earth than in your very limited philosophy.

Most contributors to RW probably accept that other contributors will have somewhat different views on certain subjects - whether matters of opinion or approach, or even 'slightly peculiar' - but are prepared to cooperate, agree to differ or enjoy discussing their opinions.

"When my information changes, I alter my conclusions. What do you do, sir?" (JM Keynes) 86.146.99.29 (talk) 21:14, 27 May 2017 (UTC)

Well my approach is simple... Atheism is a disease that has spread very rapidly over the last century... And we should eradicate this illness from the society as quickly as possible!--Kingdamian1 (talk) 21:16, 27 May 2017 (UTC)

Atheism is not a disease.

Atheism can be a belief system.

There are #many, many# major crimes and acts of destruction carried out in the name of faith.

Therefore KD1 is #very# wrong. 86.146.99.29 (talk) 21:23, 27 May 2017 (UTC)

Faith has nothing to do with sick people... Yes! Atheism IS A BELIEF system... but it is also a disease...--Kingdamian1 (talk) 21:32, 27 May 2017 (UTC)

Some of us here (of whatever belief systems) think that 'thinking atheism is a disease' is a sign of a diseased mind.

I have yet to seen any evidence of you, Kingdamian1, persuading anyone to change their views in the most infinitesimal degree towards your worldview. You are probably having a considerable effect in persuading people to do the reverse. 86.146.99.29 (talk) 21:48, 27 May 2017 (UTC)

Trying to convert an atheist is like trying to convert a flat earther Kingdamian1 (talk) 04:11, 28 May 2017 (UTC)

To answer your original question, why would you want to be friends with someone who's doomed to eternal torture? Christopher (talk) 07:53, 28 May 2017 (UTC)

Look at the flat earth-ists websites: they #are# nutters - why would governments 'hide the truth' and allow the promotion/teaching of 'round-earthism' - and some of the remarks #are# racist. Atheists are of a diverse series of persuasions.

On your user page, Kingdamian (is there any significance in your use of 'King Damian' when Damian is the Devil's son in the Omen series?), it says 'If we define hell as a place where there is no God, no morals, no purpose and no meaning, wouldn't that be an atheist's paradise' is #wrong on every level# - atheists probably do not believe in heaven and hell, and 'the purpose of hell' is to punish those who are 'irredeemably evil' (legitimate reason to mention Adolf Hitler, Pol Pot and many others).

All you are doing is convincing us other users of the need for a more inclusive/tolerant viewpoint. 31.51.113.169 (talk) 09:44, 28 May 2017 (UTC)

Rational wiki is censoring me[edit]

Anyone here gets to block me at their whim... for days sometimes... One of the block reasons in my block log... is just being a creationist... That's what I was blocked for once!!!! Isn't there any warning before blocking me for 3 days???????--Kingdamian1 (talk) 15:03, 30 May 2017 (UTC)

Help! Help! I'm being repressed! You were blocked for 1 second for "being a creationist". I unblocked you ages ago. Christopher (talk) 15:11, 30 May 2017 (UTC)

But isn't it scary that anyone has the power to block me for even a week, for whatever reason?--Kingdamian1 (talk) 15:20, 30 May 2017 (UTC)

No, not really. Christopher (talk) 15:23, 30 May 2017 (UTC)

If you were unfairly blocked you'd be unblocked by someone pretty soon (I'm surprised it took so long in this case actually, probably something to do with being blocked by a mod). Christopher (talk) 15:33, 30 May 2017 (UTC)

I AM STILL NOT UNBLOCKED!!! I can write here, but I can't edit other things!--Kingdamian1 (talk) 15:35, 30 May 2017 (UTC)

That's weird, if you check the block log I definitely unblocked you. I blocked you for 0 seconds, did that fix it? Christopher (talk) 15:40, 30 May 2017 (UTC)

No... I am still unable to edit your talk page, for example!--Kingdamian1 (talk) 15:51, 30 May 2017 (UTC)

I have probably unblocked you. Hipocrite (talk) 15:54, 30 May 2017 (UTC)

Thanks--Kingdamian1 (talk) 15:57, 30 May 2017 (UTC)

If you are being censored it is because you are 'slightly boring', you are abusive/hostile towards other people's viewpoints, effectively state people of other persuasions than your very narrow one of having false consciousness (I know I am possibly bending the term slightly).

Probably most people on RW have views other contributors find peculiar/non-rational - but they are courteous with it. 82.44.143.26 (talk) 17:01, 30 May 2017 (UTC)

I don't take kindly to being accused of being mentally ill as if that's an insult, for instance. Christopher (talk) 17:18, 30 May 2017 (UTC)

No it is NOT AN insult... I live with serious mental illnesses (anxiety and panic disorders, hypochondria, obsessive thoughts etc.).^{— Unsigned, by: Kingdamian1 / talk / contribs}

I never suggested it was an insult, I said you used it as one. Christopher (talk) 17:56, 30 May 2017 (UTC)

Christopher - for clarification, do you agree with my 'probably...' statement (which probably 'covers most sentient minds in the universe (including constructed and hive minds etc)' as well)? 82.44.143.26 (talk) 18:18, 30 May 2017 (UTC)

Yeah, people will never agree on everything. Christopher (talk) 18:43, 30 May 2017 (UTC)

Request to Rational Wiki[edit]

If there is something you don't like. PLEASE, DO NOT BLOCK ME! Come, and tell me to stop it... Kingdamian1 (talk) 17:34, 30 May 2017 (UTC)

Blocked you for 0 seconds for making that comment. --It's-a me,

Lefty Green Mario! 17:38, 30 May 2017 (UTC)

I did it[edit]

I made a good page... James Hydrick ... When do i get a promotion?--Kingdamian1 (talk) 17:43, 30 May 2017 (UTC)

1) It's called a demotion on RW 2) Due to your first mainspace edits being page blanking, you repeating that atheism is a mental illness and you asking for it you're unlikely to get sysop for a while. Christopher (talk) 17:53, 30 May 2017 (UTC)

How many pages do I need to create?--Kingdamian1 (talk) 17:54, 30 May 2017 (UTC)

It's not about pages you create, it's about the quality of your edits and your conduct, which you lack. --It's-a me,

Lefty Green Mario! 17:55, 30 May 2017 (UTC)

If you stop using mental illness as an insult it would be a start. Christopher (talk) 17:57, 30 May 2017 (UTC)

ok--Kingdamian1 (talk) 17:59, 30 May 2017 (UTC)

Why are you so interested in being a sysop? It barely means anything here (techs and mods have all the real power). Christopher (talk) 18:07, 30 May 2017 (UTC)

That's what I asked... How do I become the mod?--Kingdamian1 (talk) 18:08, 30 May 2017 (UTC)

RationalWiki:Moderators and RationalWiki:Moderator elections. You really should look at our help pages. --It's-a me,

Lefty Green Mario! 18:14, 30 May 2017 (UTC)

So when do the elections start? Can I count on your votes?--Kingdamian1 (talk) 18:15, 30 May 2017 (UTC)

I don't think we're having any because I think we don't need new mods. --It's-a me,

Lefty Green Mario! 18:16, 30 May 2017 (UTC)

┌────────────────────────────────────────────────────────────────────────────────────────────────────┘I've never seen a mod election but I think they happen once a year meaning the next one is in January 2018? Christopher (talk) 18:22, 30 May 2017 (UTC)

As has already been suggested - create your own wiki and then you can be the bureaucrat and admin as well (local terminology may differ). 82.44.143.26 (talk) 18:31, 30 May 2017 (UTC)

Who controls the rational wiki twitter? --Kingdamian1 (talk) 18:36, 30 May 2017 (UTC)

I think it's David Gerard, why do you ask? Christopher (talk) 18:37, 30 May 2017 (UTC)

Just wonderingKingdamian1 (talk) 19:19, 30 May 2017 (UTC)

Autopatrolled is the only, I repeat only, promotion on this site. Everything afterwards is a demotion. Vive Liberté! 19:38, 30 May 2017 (UTC)

Autopatrolled is also a demotion isn't it? Even if it is only a small difference. I wouldn't know, being a lowly tech. Christopher (talk) 19:42, 30 May 2017 (UTC)

I consider it the only promotion because you can skip those annoying captchas. Vive Liberté! 19:57, 30 May 2017 (UTC)

Some people enjoy CAPTCHAs, can't think why. Christopher (talk) 20:04, 30 May 2017 (UTC)

'Guessing what the captcha question/words' is a fun and free form of betting (and some of them are amusingly weird or strangely appropriate). 86.134.53.74 (talk) 21:11, 30 May 2017 (UTC)

I didn't know you cared Christopher. :) 82.44.143.26 (talk) 15:21, 31 May 2017 (UTC)

If you're reffering to my lack of a response, I just couldn't think of anything to say. Christopher (talk) 15:23, 31 May 2017 (UTC)

The 'some people' remark (I #do# have a sense of humour). 82.44.143.26 (talk) 15:37, 31 May 2017 (UTC)

I can't find where you wrote it now but I remember answering that I agreed with it. Christopher (talk) 15:59, 31 May 2017 (UTC)

You say 'some people' above (and probably most people who come to RW agree broadly with Wikipedia rules - apart from the No Original Research' - and the local rule of 'snark not bare knuckle fighting.' 82.44.143.26 (talk) 16:17, 31 May 2017 (UTC)

Sysop[edit]

Because of your edits to and time on the wiki, ~~wizard~~ Sysop has been added to your user rights. Feel free to let your newfound POWER course through your veins. Once the high wears off, see RationalWiki:Sysop guide for more information. If you have questions, ~~bleat~~ ask away. Christopher (talk) 19:24, 30 May 2017 (UTC)

NOW WHAT do i do? Whats changed?--Kingdamian1 (talk) 19:27, 30 May 2017 (UTC)

Read the pages linked. Christopher (talk) 19:34, 30 May 2017 (UTC)

Now you start properly indenting your comments. You can also ban users, unblock users, and protect pages. Vive Liberté! 19:35, 30 May 2017 (UTC)

And stop capitalizing every random word or else you'll face more blocks. 😘 --It's-a me,

Lefty Green Mario! 18:20, 31 May 2017 (UTC)

Good call LGM. Vive Liberté! 23:19, 31 May 2017 (UTC)

I keep my promises. --It's-a me,

Lefty Green Mario! 21:42, 1 June 2017 (UTC)

Act responsibly, however[edit]

The sysop tools are a privilege, not a right — and most importantly, they are not meant as a prankster's tool kit.

Dicking around too much while you have them may cause you to lose them (though, typically with possibility for future reinstatement).

Don't mistake your demotion to sysop for an incitement to step up your on-site antics.

Sysop is given as a token of our basic trust and respect. It's up to you to make the feeling mutual, by giving the wider community the same in return via your actions. All the best, Reverend Black Percy (talk) 13:27, 1 June 2017 (UTC)

I am tempted[edit]

to blank your user/talk page just to show you what it is like. 86.134.53.69 (talk) 22:14, 31 May 2017 (UTC)

Why... What did I do?--Kingdamian1 (talk) 22:27, 31 May 2017 (UTC)

You do regularly get told off for blanking pages don't you. 86.191.125.157 (talk) 09:32, 1 June 2017 (UTC)

That's in the past, Damian went on a page blanking spree in April and that's it. Christopher (talk) 09:34, 1 June 2017 (UTC)

Just keep in mind that an eye for an eye will make the whole world blind. Reverend Black Percy (talk) 13:28, 1 June 2017 (UTC)

But BoN merely 'admitted to temptation.'

From what I understood of the quote the point is that you do #no more# than what was done to you. 86.191.125.157 (talk) 19:32, 1 June 2017 (UTC)

Actually, I don't believe in doing back what others do to you. That basically means everyone but you are left in control; free to set the bar for your retributive actions as low as they'd like (via their own detestable behavior). I believe in the "opposite" — golden — rule instead; treat others like you wish to be treated. This makes your actions the focal point, not the actions of others. That's empowerment to me. Reverend Black Percy (talk) 20:42, 1 June 2017 (UTC)

Possibly there are several different viewpoints being conflated here: Do as you would be done by (but what about Miss Whiplash and client?); the 'Wicca and other' whatever is done to you comes back to threefold; being courteous/treat others ...; and if you have to take action against someone be proportionate (there is a modern legal definition for this).

In this particular case one person did 'something naughty' and someone else 'wished to give them empathy' (and did not say they would do anything more than that): is this any different from blocking someone for 'a short period of time'? 86.191.125.157 (talk) 21:33, 1 June 2017 (UTC)

Yay![edit]

https://www.youtube.com/watch?v=-Z1ik0eAGmQ

Newest video I MADE.... it features one of the most cringiest moments in humanities history (the hypnosis)...--Kingdamian1 (talk) 00:50, 1 June 2017 (UTC)

Archiving[edit]

You should probably archive your talk page, instructions here. Christopher (talk) 13:28, 1 June 2017 (UTC)

It's fine, Percy did it for you. Christopher (talk) 13:33, 1 June 2017 (UTC)

For the curious: when dealing with the talkpage of a user, asking first is always the way to go (like Christopher did). Practically, however, it's fine to just impose archiving on talkpages as well. Archiving is a form of maintenance that's necessary to ensure a functioning talkpage (as too many topics on end will lag out smartphone users and prevent them from editing). It's also worth noting that all talkpages belong to the community, not any individual user. The only page that nobody else may edit is your userpage — and even that page faces ultimate restrictions on what you may put there. All the best, Reverend Black Percy (talk) 13:41, 1 June 2017 (UTC)

Noted (saying that always reminds me of CP). Christopher (talk) 13:51, 1 June 2017 (UTC)

Reverend Black Percy (talk) 13:53, 1 June 2017 (UTC)

What are you talking about, Rev?--Kingdamian1 (talk) 21:40, 1 June 2017 (UTC)

Stop typing particular words in all-caps[edit]

I'm referring to posts like this, where you unnecessarily write some words in all-caps. It makes your writing more of a hassle to read. I'm tired of reminding you, so once you stop writing in such an annoying way, I will stop blocking you. --It's-a me, Lefty Green Mario! 21:45, 1 June 2017 (UTC)

👏Thank👏you👏L👏G👏M👏Damian👏stop👏using👏caps👏 Koi "the spelling's on porpose!" development 21:51, 1 June 2017 (UTC)

In the same vein: could you stop using ellipsis in place of punctuation? The ones at the end of a paragragh should generally be a single period. Replacing about half the others with a comma and dropping the rest would go a long way toward readability and precision. Daev (talk) 05:03, 2 June 2017 (UTC)

Baraminology?[edit]

So, I asked this on the talk page for one of the essays you wrote a while back. I apologize if the intro seemed a bit snarky, but my curiosity is genuine regarding how closely "kinds" follows "families" as you said. I created 11 groups, some of which consist entirely of species of the same Genus, others of the same Gamily, and others of the same Order. This isn't meant to be a trap or anything; I'm genuinely curious which groups represent a single "kind", and of the ones that represent multiple kinds, which ones and why.

The most basic definition of "kind" I've heard is the general creatures God made and that were represented on Noah's boat, which have since diversified into the variety of species we see today (One pair of 'dog-kind' to produce all the wolves, foxes, domestic dogs; one pair of 'cat-kind', etc.) Is that the definition you use, that animals are all of the same Kind if they have a common ancestor represented on the Ark? If not, which definition do you use?

Also, re: those 11 groups, for simplicity's sake I'll copy them here for you:

Group 1

Group 2

Group 3

Group 4

Group 5

Group 6

Group 7

Group 8

Group 9

Group 10

Group 11

Thanks! -- Onychoprion (talk) 20:08, 6 June 2017 (UTC)

Damian appears to have gone. Christopher (talk) 17:15, 8 June 2017 (UTC)

Now that you're back, do you mind answering Onychoprion's question? Christopher (talk) 18:52, 12 June 2017 (UTC)

Give him time; I don't expect a swift answer for this. I don't think there's a standard Baraminology model Damian can reference as easily as taxonomy. -- Onychoprion (talk) 15:35, 13 June 2017 (UTC)

I'm not quite sure why there's 4 cats and a bear in the same group (group 9). Christopher (talk) 15:37, 13 June 2017 (UTC)

As I said in the intro, I made some groups to contain species that are all within an order, but of different families. Everything in Group 9 is of the order Carnivora, though grouped such that there's a clear odd-one out if, as claimed, Baramins are close to Families (rather than making 9 be a cat, a dog, a bear, and a weasel). As I said I'm not trying to be sneaky or tricky with these groups; just trying to see how closely Baramins match Families. -- Onychoprion (talk) 15:41, 13 June 2017 (UTC)

I am not sure I can help you... or go through all that! Additionally, we are not told that much in the Bible... we are told that there were animals created, who reproduced after their kind... I can give 1 or 2 examples... But I am not sure I can group them like this!--Kingdamian1 (talk) 23:44, 13 June 2017 (UTC)

If that's the case, then I'd say it's hardly scientific. It doesn't describe anything, or rather, it can be made to describe anything. The only detail in Genesis 1 and 2 (which are more specific than either flood story) we get is there are plants, trees, birds, fishes, beasts of the earth, and cattle. To satisfy plurals, God could've created 2-4 ancestor plants, 2-4 ancestor trees, 4 ancestor fish, 4 ancestor birds, 4 ancestor wild animals, and 4 ancestor domesticated animals, with everything we see today (including extinct species, bacteria, ) ~~evolving~~ developing from them. It could equally mean that God created stable breeding populations of every species, which numbers in the quadrillions at least.

I'm assuming you'd have an issue with every single fish, from sharks to lampreys to clownfish, sharing a common ancestor, even though by your definition that's perfectly in-line with the Bible. Also cows and horses and sheep and dogs would have a common ancestor (or, at best, be separable into two common-ancestor groups). Every bird, from ostrich to penguins to terns to parrots, likewise. But that agrees with the Bible! Is that a possibility for Baramin? -- Onychoprion (talk) 00:03, 14 June 2017 (UTC)

Worry[edit]

People worry about what kind of a planet we are leaving for our children... I worry what kind of children are we leaving for this planet--Kingdamian1 (talk) 04:34, 11 June 2017 (UTC)

That is slightly unkind - given that many children are perfectly reasonable. Don't blame the children (except when they are creating a racket/mess) - blame their parents. 82.44.143.26 (talk) 18:39, 12 June 2017 (UTC)

1) Define "garbage". 2) Do you have any statistics to back up your assertion that most children are "garbage"? (You're less likely to notice well behaved children so "all of the children where I live are garbage" isn't enough. Christopher (talk) 18:50, 12 June 2017 (UTC)

And there is an 'irregular verb' - my children are lively, yours are annoyingly boisterous, and theirs are #### oiks. 86.146.100.44 (talk) 21:52, 12 June 2017 (UTC)

one thing atheists and theists agree on, people need to raise their children better.--Rimuru Tempest (talk) 21:57, 12 June 2017 (UTC)

Well, I'm sure that everyone agrtees that parents should do the best job they can of raising their children. But it's not a very profound thing to agree on - does anyone take the opposite stance?--Bob ^{"Life is short and (insert adjective)"} 05:45, 13 June 2017 (UTC)

Maybe I've misunderstood it but don't proponents of unschooling think that parents shouldn't bother raising their children at all and let them do it all themselves? That's the closest I could think of. Christopher (talk) 15:13, 13 June 2017 (UTC)

Usually when I write here... It's raw emotions (frustration etc)... I should have worded it more correctly... But, I do think that kids are more rude today!--Kingdamian1 (talk) 23:41, 13 June 2017 (UTC)

Perhaps you could promote the No Cussing Club? Or invent some swearwords and confuse them. 82.44.143.26 (talk) 17:42, 14 June 2017 (UTC)

Why'd you delete the Fornication Essay?[edit]

Question's in the title. Pretty sure it's not outside of your rights if you created the essay page, but it also seeks kinda jerkish to do that when there was a semi-lively discussion on the talk page. Maybe move it to a forum/debate? -- Onychoprion (talk) 23:17, 12 June 2017 (UTC)

He would be within his rights to delete the essay. But he has no right to delete the talk page.--Bob ^{"Life is short and (insert adjective)"} 05:42, 13 June 2017 (UTC)

Oh, he's just a scrub. Fixed it. Reverend Black Percy (talk) 14:16, 13 June 2017 (UTC)

I created the page? Why can't I delete it (though I am not going to yet)?--Kingdamian1 (talk) 23:43, 13 June 2017 (UTC)

See deletion The essay is yours but: "Talk pages should never be deleted. This includes talk pages in editor userspaces."--Bob ^{"Life is short and (insert adjective)"} 06:30, 14 June 2017 (UTC)

Noah's Ark[edit]

Would I be right in assuming that, as a creationist you believe in the Noah's Ark story and the global flood and all? Is that right? If so, would you mind answering a few questions about the ark story?--Bob ^{"Life is short and (insert adjective)"} 20:34, 14 June 2017 (UTC)

I do believe what the Bible says--Kingdamian1 (talk) 21:11, 14 June 2017 (UTC)

Good. Now instead of bothering with this satanic shithole, just vandalize it. Heck, even when I make legitimate edits (like on mall ninja), these idiots just revert it for no reason. Vandalism is more fun, it pisses them off more. 172.58.15.12 (talk) 21:14, 14 June 2017 (UTC)

Sorry about taking a so long to get back on this. Do you have an explanation for how kangaroos and koala bears managed to get to Australia after the flood? And why they left no descendents along the route? (Similar questions could be asked about - for example - sloths, in South America.)

I know there plenty of other "How did X work?" questions about the bible story but I'd be interested to hear your answer to this one first. Thanks.--Bob ^{"Life is short and (insert adjective)"} 13:57, 18 June 2017 (UTC)

I don't think Genesis mentions that--Kingdamian1 (talk) 18:27, 18 June 2017 (UTC)

That's because all that there is the pop culture version of the tale, what you see from cartoons and comic books. See also TV Tropes' "Theme Park Version" Chair tater (talk) 02:02, 19 June 2017 (UTC)

Cringe comedy eh? Yeah, humor isn't exactly your "thing"... I don't care about your stupid opinion. Go and share them with other ungodly morons!Kingdamian1 (talk) 02:11, 19 June 2017 (UTC)

I don't care for your opinions either. Or your proselytizing. Or your faith. No one here does. No one here likes you. I don't like you. The little girl don't like you. ("Yeah! Push the goddamn button!" Quiet kid, I'm going somewhere with this.) Chris Tucker probably doesn't like you. Jackie Chan won't like you. And yes, I recently rewatched Rush Hour the other night. Still a good comedy, still holds up. The sequels? Eh, I don't mind 'em. The TV series? Totally unnecessary, and canceled. But that's CBS' problem. Chair tater (talk) 02:32, 19 June 2017 (UTC)

Like I said... cringe... your humor is funny because it is UNFUNNY! I need not have to listen to your trash... Go talk with other morons! Leave me, you fornicating sucker!Kingdamian1 (talk) 02:39, 19 June 2017 (UTC)

┌────────────────────────────────────────────────────────────────────────────────────────────────────┘ Tater. Chill. Ad hominem never solves problems. L'homme Idéal (je rigole). 02:53, 19 June 2017 (UTC)

"Kingdamian1: "I don't think Genesis mentions that." No it says nothing at all about it. But as you apparently believe it happened I was wondering what explanation you (or your co-religionists) might have.--Bob ^{"Life is short and (insert adjective)"} 21:00, 19 June 2017 (UTC)

Suckers[edit]

I pray for the day when all atheism is uprooted from society. Atheism is cancerous! I am against it. Immorality/ungodliness is the single biggest threat in the society right now--Kingdamian1 (talk) 23:04, 18 June 2017 (UTC)

Why are you here? You clearly don't like being here. Why not go to some ultra-religious wiki instead? You might be much more happier there, maybe. Chair tater (talk) 02:24, 19 June 2017 (UTC)

Perhaps he's just trolling us.-⇂ɔsᴉᗡpuoɯɐᴉᗡ (talk) 02:26, 19 June 2017 (UTC)

I don't take advice from ungodly/immoral people... This is a shit hole where liberals bitches come to vent... I enjoy laughing at suckers here! --Kingdamian1 (talk) 02:27, 19 June 2017 (UTC)

Yep, troll.-⇂ɔsᴉᗡpuoɯɐᴉᗡ (talk) 02:30, 19 June 2017 (UTC)

'I'm a Christian but I also have no problem using foul language' — seems legit. If atheism is a cancer then what is religion? An STD? Something worse than cancer? 锦鲤 (说) 02:32, 19 June 2017 (UTC)

Immoral people like you sicken me... sorry if I blow up from time to time... I am confident we will have a cure for hopelessness, immorality and atheism in the near future... so people like you will be reduced in frequency!--Kingdamian1 (talk) 02:35, 19 June 2017 (UTC)

Q.Q You must not like Pharmercy.. that's the only explanation for me sickening you. You're dead to me, Damian. You cannot deny the power of the first of the two Overwatch OTP pairings. A cure for hopelessness? Sartre's existentialism. Immorality? Freedom from religion and good laws. Atheism? Don't fix what ain't broke. Decidedly not a sock of User:Fareeha_A 02:49, 19 June 2017 (UTC)

That's a lot of blah blah blah... Psalm 14:1... We will eradicate atheism from society whether you liberal losers like it or not--Kingdamian1 (talk) 02:57, 19 June 2017 (UTC)

I think I should mention that your mainpage says: "We welcome contributors, and encourage those who disagree with us to register and engage in constructive dialogue."

So as long as Kingdamian1 isn't actually abusive I have no problem with him. In fact he's one of the more amusing editors. (Though it is kind of hard to pin him down on stuff.)--Bob ^{"Life is short and (insert adjective)"} 21:05, 19 June 2017 (UTC)

-- Onychoprion (talk) 21:26, 19 June 2017 (UTC)

KD claims he actively dislikes atheism and uses language he knows some people dislike - yet persists in contributing to RW and using such language. Is he slumming it, trolling, expressing a masochistic streak, trying to annoy people.... 31.51.114.103 (talk) 22:38, 19 June 2017 (UTC)

I have no problem with Damian. I quite like the guy. The language I only mentioned because the apostle Paul mentions 'no obscene words' or something to that extent. As for his reasons for being here? I don't really care and I'm sure he has his own. So long as he isn't vandalising the place he's free to stay as long as he likes imo, even if he is just trolling. Certainly not Anonymous user, whoever that is.^{[{{#rand:1|4}}][{{#rand:4|10}}]} 22:50, 19 June 2017 (UTC)

So what if he's a troll? RW isn't a safe-space against trolling, intentional or otherwise. I'd rather keep Damian, since a) he's not vandalizing pages and b) he's at least semi-constructive, if a bit ... brash. And when he's not abandoning threads. Still, nowhere near activity that'd warrant banning. Else, who wouldn't be able to be banned?. -- Onychoprion _{Edit: Just to clarify, that's in response to BoN, not Koi}(talk) 22:53, 19 June 2017 (UTC)

'Cod psychological analysis' perhaps - and are these suckers] being referred to? 86.134.53.8 (talk) 09:37, 20 June 2017 (UTC)

Who goes to Hell?[edit]

I'm not surprised you want to duck the Noah's Ark one above so I thought I try another one. Who, in your opinion, goes to (the Christian version of) hell? And what do you think Hell is? --Bob ^{"Life is short and (insert adjective)"} 12:58, 20 June 2017 (UTC)

Hell is a place where there is no God! Hence no rules, morals or purpose!--Kingdamian1 (talk) 17:25, 21 June 2017 (UTC)

But who is sent to the Christian Hell and what happens there? (I'm' sorry of the question wasn't clear enough before.)--Bob ^{"Life is short and (insert adjective)"} 17:29, 21 June 2017 (UTC)

Hell is a place where there is no God! Hence no rules, morals or purpose! --Kingdamian1 (talk) 17:30, 21 June 2017 (UTC)

So - this is another one you can't answer?--Bob ^{"Life is short and (insert adjective)"} 17:36, 21 June 2017 (UTC)

I believe I just did!Kingdamian1 (talk) 17:37, 21 June 2017 (UTC)

"Who goes to prison?" "Prison is a place with bars and guards!" Nope, still doesn't answer the question. Who goes to Hell? -- Onychoprion (talk) 17:37, 21 June 2017 (UTC)

Yes, on this page we've got him failing to come up with any response to questions about slavery, the flood and hell. There was one about Christians and homosexuality he ran away from as well.--Bob ^{"Life is short and (insert adjective)"} 17:43, 21 June 2017 (UTC)

When devils go on holiday do they do a busman's holiday and visit the hells of other religions?

And 'in a location in space between galaxies where nothing ever happens beyond the bubbling of particles in and out of existence is there a God? And if the gods of the various religions divide up the universe between them is 'hell' everywhere where your particular god is not?

What do 'the universe' and 'morals' and 'the universe' and 'purpose' have in common? (As the rules or laws of physics will apply everywhere - we have just not yet discovered the rules and laws operating within black holes and between branes.) 82.44.143.26 (talk) 18:01, 21 June 2017 (UTC)

Could you answer the question? Christopher (talk) 20:46, 30 June 2017 (UTC)

The people who don't accept Jesus!--Kingdamian1 (talk) 14:43, 1 July 2017 (UTC)

Including people who've never heard of him? Babies? Christopher (talk) 15:00, 1 July 2017 (UTC)

Shouldn't be too hard, it's a simple yes/no question. Christopher (talk) 19:22, 1 July 2017 (UTC)

No! Not Babies... People who have heard of Him and rejected Him--Kingdamian1 (talk) 00:43, 2 July 2017 (UTC)

So someone who has heard of Jesus and respects him as a teacher of ethics, morality and other things, but is not a Christian would not go to hell? 82.44.143.26 (talk) 16:27, 3 July 2017 (UTC)

I'm curious Kingdamian1, to which denomination of Christianity do you adhere? Not Catholic, obviously; but I can't quite match your answers on the Fate of the Unlearned to those of the major groupings I know. Daev (talk) 17:09, 3 July 2017 (UTC)

I Don't belong to ANY denomination!Kingdamian1 (talk) 23:22, 3 July 2017 (UTC)

Are there any theologians whose work you accept as a basis for your own beliefs? If not - ie if it is all you - perhaps you should take a day or two to build an essay on this question (Fate of the Unlearned/Destiny of the Unevangelized or the wider question of how one avoids formal damnation). If you truly don't follow any of the existing traditions then that would probably be a more enlightening than disparate responses to "What about this group..." questions. Daev (talk) 12:38, 4 July 2017 (UTC)

I HONESTLY don't belong to ANY denomination... And I do not got to church or follow any traditions... For educational purposes I can read or appreciate the work of any theologian... But I can't really say I follow any of those...Kingdamian1 (talk) 15:04, 4 July 2017 (UTC)

So anybody who follows any denomination of Christianity is good for Heaven?--Bob ^{"Life is short and (insert adjective)"} 16:53, 4 July 2017 (UTC)

Do you support going to obscure places and telling any natives about Jesus? If you do then you support sending people to be tortured for eternity because not all of them will accept Jesus, if you don't then goes against all of Jesus' teachings about evangelism. Christopher (talk) 16:59, 4 July 2017 (UTC)

'The proverbial Viking' looks at the above exchange: 'I want to go to Valhalla - much feasting, much fighting - your milk and water heaven with nothing but singing sounds like hell to me.' (Goes off a-roving to explore the heavens of all the faiths.) 82.44.143.26 (talk) 17:30, 4 July 2017 (UTC)

Anyone who accepts Jesus will have eternal life.--Kingdamian1 (talk) 19:10, 4 July 2017 (UTC)

I think we could have guessed that was your position, it doesn't really answer the questions people have asked you though. Where do people who haven't heard of Jesus go if it isn't Hell? I presume they don't get a free ticket to Heaven? Christopher (talk) 19:29, 4 July 2017 (UTC)

The Christians who believe that only they will go to heaven have an exclusive area there: most of the rest of us who have been 'reasonably good' end up exploring the rest of heaven (and some of the other options available). 31.49.115.236 (talk) 21:33, 4 July 2017 (UTC)

The servant who knows the master’s will and does not get ready or does not do what the master wants will be beaten with many blows. 48 But the one who does not know and does things deserving punishment will be beaten with few blows. From everyone who has been given much, much will be demanded; and from the one who has been entrusted with much, much more will be asked Kingdamian1 (talk) 04:39, 5 July 2017 (UTC)

I find that hitting your slave 42 times works the best. You tell them that you are going to hit them 48, but stop at 42 to show that you are a nice master. 2d4chanfag (talk) 05:40, 5 July 2017 (UTC)

Beating your employees is illegal in any jurisdiction under which I would care to live. Do you hold that it be moral, or justified? Also, don't just quote/copypaste verse at us - give us your interpretation of what it teaches. Daev (talk) 09:01, 5 July 2017 (UTC)

From [2] and other websites:

If I find myself born or drafted into a universe wherein the laws of nature do not obey consistent principles, I will depart for an alternate universe created by a more reasonable author.

The sort of God KD1 describes seems to fall into this category.

Rationalwikians probably don't object to an austere god who wants them to live up to the standards (but accepts that 'people may get diverted into doing things that seem amusing at the time) - but a god who does not accept the diversity of human nature that 'he himself' (alter pronoun to taste) has created or allowed to develop and would rather punish entire groups rather than encourage them to become better seems irrational. (And you cannot argue that god is more than us - we were created in 'his' image so logically we should have some understanding of 'his' mental processes.) 86.146.99.73 (talk) 10:03, 5 July 2017 (UTC)

DO YOU GUYS EVEN REALISE THIS IS FROM A PARABLE... which illustrates the point that I was making... NOT THE SAME PUNISHMENT FOR ALL!!!!!!!!!--Kingdamian1 (talk) 21:03, 5 July 2017 (UTC)

No need to shout but ANSWER THE QUESTION - WHO DO YOU, KINGDAMIAN1 think that 'really good people' should be sent to hell just because they do not accept Christianity but 'a really nasty person' who does, will go to heaven? 86.146.99.73 (talk) 21:22, 5 July 2017 (UTC)

"People who have heard of Him and rejected Him [will go to Hell]" So, wouldn't the best thing to do be to not proselytize, then? If people who've never heard of Jesus automatically go to Heaven, then you should be actively working to make Jesus as obscure and unknown as possible. -- Onychoprion (talk) 21:43, 5 July 2017 (UTC)

Who are the good people and who are the nasty people?--Kingdamian1 (talk) 00:06, 6 July 2017 (UTC)

How do you define "nasty" and "good"? Does a "nasty" person who accepts Jesus as their savior because they know Jesus' blood can wash away any sin get into heaven? Does a good person who doesn't accept Jesus, but heard about him (say, a pious Buddhist) go to Hell? -- Onychoprion (talk) 00:59, 6 July 2017 (UTC)

Hitler, Pol Pot, those who abuse their positions in children's homes, and those who cause destruction in the name of religion are examples of 'nasty people' (whether or not Christian). People who aim to make the world a better place (even by being nice/polite to people they encounter) are 'good people'. 31.51.114.76 (talk) 10:05, 6 July 2017 (UTC)

And who decides this?--Kingdamian1 (talk) 20:10, 6 July 2017 (UTC)

Given the number of posts you've ~~avoided~~ not got round to responding to, you're going to have to be more specific about who that last comment was addressed to. Christopher (talk) 20:20, 6 July 2017 (UTC)

Someone was trying to explain who the good and nasty people are... so I asked who decides this?--Kingdamian1 (talk) 13:14, 7 July 2017 (UTC)

Don't let the BoN distract you KD. We were already asking you how your particular brand of Christianity (which as far as I can tell is only followed by yourself) defines Hell, determines who is sent there, and whether ignorance of Jesus' existence affects that determination. Daev (talk) 13:42, 7 July 2017 (UTC)

I HAVE NO IDEA what you mean by particular brand of Christianity. I follow the Bible and teachings of Jesus... I do not know any other "brand"--Kingdamian1 (talk) 14:14, 7 July 2017 (UTC)

Really? You have declared yourself to not belong to any denomination or theological tradition. So I used the term brand to refer to your individual interpretation of the teachings of Jesus and the Bible. The most apropos term would actually be heresy, I think (ie belief or opinion contrary to orthodox religious doctrine); but I refrained from the use of a term which is often accusatory, as I did not want to cause offense. Daev (talk) 14:29, 7 July 2017 (UTC)

[EC]You've got some odd ideas regarding the Bible, Daev was asking you to provide biblical/reality based (either will do) support that your interpretation of the Bible is "correct". Are you capable of actually answering the question? Christopher (talk) 14:32, 7 July 2017 (UTC)

Actually, I'd just as happily settle for him formally laying out what his interpretation actually is. Daev (talk) 14:34, 7 July 2017 (UTC)

There are 'many' varieties of Christianity some of which promote concepts that are in direct competition to those of other varieties.

If the people mentioned by the other BON had just before their deaths said they believed in Jesus would you allow them into heaven - or would you argue (as many RWians might argue) 'by their evil deeds shall you know them, and to the devil with them'? Would you, KD, argue that someone 'known for their good deeds' and who has come across the name and deeds of Jesus but does not pursue the matter should automatically go to hell?

If so 'ain't right ain't fair ain't proper.' 82.44.143.26 (talk) 14:46, 7 July 2017 (UTC)

You people keep asking me if good people go to heaven... but won't say what you mean by "good"... I interpret the Bible as the word of God... I am a Christian. I think that is sufficient. --Kingdamian1 (talk) 15:54, 7 July 2017 (UTC)

Let's say Bill Gates rejected Jesus, but spent the rest of his life and his fortune aiding the least among us, building water purification infrastructure in Africa, setting up food distrobution centers, etc., saving tens of millions of lives. Likewise, let's say Pol Pot, right before his death, saw the light and confessed and accepted Jesus as his personal savior. Where would they go? -- Onychoprion (talk) 16:14, 7 July 2017 (UTC)

So... in that case... why is Bill Gates good? Who decides this? Who decided that contributing to the poor was good? Good in whose eyes?--Kingdamian1 (talk) 16:31, 7 July 2017 (UTC)

We're discussing your personal, unique version of reality here, not actual reality. We're assuming God decides.

You've still failed to provide Biblical support for your rather odd views. Christopher (talk) 16:39, 7 July 2017 (UTC)

Damian, I didn't say Gates was good, I just gave a hypothetical. But if you must, Jesus Himself said "When the Son of Man comes in his glory, and all the angels with him, he will sit on his glorious throne. All the nations will be gathered before him, and he will separate the people one from another as a shepherd separates the sheep from the goats. He will put the sheep on his right and the goats on his left. Then the King will say to those on his right, ‘Come, you who are blessed by my Father; take your inheritance, the kingdom prepared for you since the creation of the world. For I was hungry and you gave me something to eat, I was thirsty and you gave me something to drink, I was a stranger and you invited me in, I needed clothes and you clothed me, I was sick and you looked after me, I was in prison and you came to visit me.’ Then the righteous will answer him, ‘Lord, when did we see you hungry and feed you, or thirsty and give you something to drink? When did we see you a stranger and invite you in, or needing clothes and clothe you? When did we see you sick or in prison and go to visit you?’ The King will reply, ‘Truly I tell you, whatever you did for one of the least of these brothers and sisters of mine, you did for me.’" (Matt 25:31-40 NIV) and "If you want to be perfect, go, sell your possessions and give to the poor, and you will have treasure in heaven. Then come, follow me." (Matt 19:21 NIV), which I based my hypothetical Gates off of. So would the Jesus-rejecting hypothetical Gates go to Heaven or Hell? What about the Jesus-accepting Pol Pot? -- Onychoprion (talk) 20:24, 7 July 2017 (UTC)

Edit conflicts and resetting indents for more manageable block of text.

First, we don't keep asking that. A few people have used the term in asking you about you answer to a theological question. This took place well after you started avoiding the question first raised (What is Hell and who goes there?).

Assuming that 'good' is a useful term in answering that question, you could assume common vernacular and take the first definition on (say) dictionary.com ("morally excellent; virtuous; righteous; pious"), you could ask for a definition to use for the purposes of this discussion, or you could propose your own definition for the purposes of the discussion.

However, I do not think that 'good people' and 'bad people' is a useful distinction to make with regards to this question. Holy/Unholy or Consecrated/Profane may be more useful. Take, for example, the scenario of a person who has performed acts forbidden by the commandments - yet who sincerely "accepts Jesus" on their deathbed. What is the disposition of their soul.

Note that the scenario is mentioned as a demonstration of why I think that the Good/Bad dichotomy is not useful to the current discussion; not as a specific which I am asking you to answer.

The questions under discussion (according to my reading) are the original "What is Hell and who goes there?" and "What about those who never had the opportunity to know of Jesus - are they damned by default?"

The second comes from one of your responses to the first (ie "The people who do not accept Jesus")

Also you claim the Bible as the source of your theology. Great! Which Bible? The original text? One of the many, many translations since? One of those which came about because of printing error's?

When we ask you for your interpretation, we are not asking "from were to you think the words came?" but "what do you think the words mean?"

So:

1) What is Hell?

You earlier defined it (more or less) as the absence of God's presence. Fair enough (on my part).

2) What determines if one goes to Hell after death?

Closest to an answer on that was 'Whether you accept Jesus.' Well, accept Jesus as what? What does it mean to accept Jesus? What else (for example, a code of conduct) is implicit in one accepting Jesus?

3) What of those who were not exposed to the teaching of Jesus? This follows directly from your response quoted in the previous sentence.

Daev (talk) 16:44, 7 July 2017 (UTC)

Colloquially 'a good person' is someone who benefits society/the world, and 'a bad person' subtracts. And then there are 'certain persons' whom most other people would regard as evil (Hitler, Pol Pot etc).

All the people who have caused damage in the name of Jesus (including the Inquisition) - do they go to Heaven or Hell?

And what happens with the Viking mentioned above who wants to go to Valhalla with different gods - and others of different persuasions? 86.145.120.222 (talk) 20:16, 7 July 2017 (UTC)

So who decides that? Who decides who the good person is?--Kingdamian1 (talk) 00:28, 8 July 2017 (UTC)

I think KD1 has answered the original question. Just saying. RoninMacbeth (talk) 05:25, 8 July 2017 (UTC)

And how does The Satanic Temple fit into the KD1-verse? 31.51.113.108 (talk) 09:15, 11 July 2017 (UTC)